G2C::Genetics

Mutation

E14TG2a mouse embryonic stem (ES) cells were targeted with a vector containing 2.7kb and 6.6kb of flanking genomic DNA. This replaced 1.9kb of Cnksr2 genomic DNA (X154431703 to X154433564; Ensemble Build 50) with IRES-lacZ-neo cassette. Correctly targeted ES cells were identified by long range PCR using Expand Long Template PCR system (Roche Cat 11681842001). The PCR contained primer X (5’- GAGCTATTCCAGAAGTAGTGAG -3’) and primer W (5’- GTAGGTCTTGATGACTGTTTGC -3’) that correspond to sequence in the IRES-lacZ-neo cassette and sequence outside the 2.7kb flanking region respectively.

The correctly targeted ES cells were injected into C57BL/6 blastocysts to create chimeric mice, which were bred with 129S5 mice to generate heterozygous (+/–) Cnksr2 mutant mice. Those F1 heterozygous mice had been backcrossed with 129S5 mice for 1-2 times before being used for intercrossing.

Location of Cnksr2 gene trap. Cnksr2 is a 22 exon gene encoding the MAGUIN-1 protein which contains SAM, PDZ, Cnksr2 and PH domains (top). We replaced most of Cnksr2 3rd exon with a selection cassette in targeted mice and created a frameshift between exons 3 and 4. Primers used for targeted clone identification (w&x) are shown.

Genotyping

Genomic DNA was isolated from ES cells by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 269bp product amplified from the wild-type (wt) allele using a forward primer A (CACTCTTCCTCCAACTCTTTC) in the wt sequence deleted by targeted mutation and a reverse primer B (CTCTTACTTGTCCCTGTGCAG) downstream of the cassette. A 399bp product was amplified from the targeted allele using primer B with forward primer X, within the selection cassette. After enzymatic amplification for 35 cycles (45 seconds at 94 °C, 45 seconds at 55 °C, and 1 minute at 72 °C), the PCR products were size-fractionated on a 2% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (a,b & x). PCR genotyping of targeted MAGUIN-1 mice using a common reverse primer, b, and forward primers a and x to amplify the wt and mutant alleles respectively.

Expression

Total RNA was extracted from whole mouse brain using RNeasy Midi kit (Qiagen, Cat 75144). RT-PCR was performed by generating first strand cDNA and using a forward primer, Y (CTACGCATTACACATCAGGAG), which anneals to exon 2 and a reverse primer, Z (CTCAGTTGTGGATCTGATTGG), which anneals to exon 3. A product of 266bp was generated from WT cDNA and no product detected from hemizygote cDNA where the exons have been replaced by the cassette.

Primers used for RT-PCR (y&z). RT-PCR genotyping - forward primer, Y in exon 2 and reverse primer, Z in exon 3, amplification occurs in wt mice but no band in targeted mice where exon 3 has been replaced by the selection cassette.

Breeding

Cnksr2 resides on the X chromosome: birth of MAGUIN-1 ^-/Y mice followed Mendelian ratios with 24% of offspring being hemizygous knockouts but no female MAGUIN-1^-/- mice were born. Genotypes of 3-week-old pups from MAGUIN-1 backcrosses identified 64 wt, 34 female MAGUIN-1 -/+ and 28 MAGUIN-1 ^-/Y male progeny (Χ² p= 0.401). Male MAGUIN-1 ^-/Y developed normally to adulthood, exhibited normal body size and no gross abnormalities. Backcrosses onto the 129S5/SvEvBrd background were used to maintain the colony and to generate hemizygous and wildtype mice to study.

Overview

Mutant mice showed little overall behavioural difference from wildtypes, with only one behaviour variable, EPM % time in open, significantly increased in these mutant mice. Definitions of variables may be found below.

The G2CMine data warehouse provides cohort summaries and individual mouse observations from the MAGUIN-1 knock-out line phenotyping.

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM. OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field. RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1. Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable	Units	Wildtype M (n=11)	Wildtype F (n=0)	Mutant M (n=12)	Mutant F (n=0)	P(sex×mutation)	P(mutation)
EPM total distance	cm	705 (65)	-	813 (95)	-	-	0.37
EPM max speed	cm/s	14.5 (1)	-	14.5 (1.1)	-	-	1
EPM % time in open	%	18.5 (8.3)	-	48 (9.9)	-	-	0.034 *
EPM time in centre	s	139 (12)	-	137 (21)	-	-	0.92
EPM max speed, open vs closed	cm/s	-5.4 (1.4)	-	-3.3 (1.4)	-	-	0.31
OF, NOE total distance	log10 cm	3.16 (0.1)	-	3.14 (0.08)	-	-	0.87
NOE vs OF distance travelled	cm	-339 (128)	-	-39 (85)	-	-	0.06
RR naive fall time	log10 s	0.96 (0.11)	-	1.06 (0.08)	-	-	0.45
RR learning	s/trial	1 (0.7)	-	1.8 (0.9)	-	-	0.47
RR memory	s	9.8 (5.5)	-	9 (3.9)	-	-	0.91
Fear learning, trial effect	% freezing	46.5 (8)	-	45.5 (8.7)	-	-	0.93
Fear learning, tone effect	% freezing	8.9 (5.4)	-	-6.6 (7.3)	-	-	0.11
Contextual memory, mean	% freezing	50.7 (7.7)	-	39.2 (7.4)	-	-	0.29
Contextual memory, change	% freezing	16.2 (8.1)	-	15.8 (6.9)	-	-	0.97
Cued memory, mean	% freezing	-1.3 (6.4)	-	5.5 (4.4)	-	-	0.39
Cued memory, change	% freezing	-13.1 (7.9)	-	-6.7 (8.2)	-	-	0.58

Elevated Plus Maze

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM.

 

Variable	Units	Wildtype M (n=11)	Wildtype F (n=0)	Mutant M (n=12)	Mutant F (n=0)	P(sex×mutation)	P(mutation)
EPM total distance	cm	705 (65)	-	813 (95)	-	-	0.37
EPM max speed	cm/s	14.5 (1)	-	14.5 (1.1)	-	-	1
EPM % time in open	%	18.5 (8.3)	-	48 (9.9)	-	-	0.034 *
EPM time in centre	s	139 (12)	-	137 (21)	-	-	0.92
EPM max speed, open vs closed	cm/s	-5.4 (1.4)	-	-3.3 (1.4)	-	-	0.31

Open Field/Novel Object

 

Variables shown are: OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field.

 

Variable	Units	Wildtype M (n=11)	Wildtype F (n=0)	Mutant M (n=12)	Mutant F (n=0)	P(sex×mutation)	P(mutation)
OF, NOE total distance	log10 cm	3.16 (0.1)	-	3.14 (0.08)	-	-	0.87
NOE vs OF distance travelled	cm	-339 (128)	-	-39 (85)	-	-	0.06

Rotarod

 

Variables shown are: RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1.

 

Variable	Units	Wildtype M (n=11)	Wildtype F (n=0)	Mutant M (n=12)	Mutant F (n=0)	P(sex×mutation)	P(mutation)
RR naive fall time	log10 s	0.96 (0.11)	-	1.06 (0.08)	-	-	0.45
RR learning	s/trial	1 (0.7)	-	1.8 (0.9)	-	-	0.47
RR memory	s	9.8 (5.5)	-	9 (3.9)	-	-	0.91

Fear Conditioning

 

Variables shown are: Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable	Units	Wildtype M (n=11)	Wildtype F (n=0)	Mutant M (n=12)	Mutant F (n=0)	P(sex×mutation)	P(mutation)
Fear learning, trial effect	% freezing	46.5 (8)	-	45.5 (8.7)	-	-	0.93
Fear learning, tone effect	% freezing	8.9 (5.4)	-	-6.6 (7.3)	-	-	0.11
Contextual memory, mean	% freezing	50.7 (7.7)	-	39.2 (7.4)	-	-	0.29
Contextual memory, change	% freezing	16.2 (8.1)	-	15.8 (6.9)	-	-	0.97
Cued memory, mean	% freezing	-1.3 (6.4)	-	5.5 (4.4)	-	-	0.39
Cued memory, change	% freezing	-13.1 (7.9)	-	-6.7 (8.2)	-	-	0.58

Overview

Mutant slices showed medium overall electrophysiological difference from wildtype slices, with three of nine variables significantly impacted in these mutant slices. In the paired pulse facilitation experiment, PPF at 50ms ampl ratio was significantly decreased in mutants. In the theta burst stimulation experiment, one electrophysiological variable, burst 1 PPF at 10ms ampl ratio, was significantly decreased in mutants. In the long term potentiation experiment, one electrophysiological variable, LTP based on amplitude, was significantly decreased in mutants. Only the basal synaptic transmission experiment was unaffected. Note that in the theta burst analysis, the tenth burst is analysed as representative of individual burst amplitude. Definitions of variables may be found below.

The G2CMine data warehouse provides slice group summaries and individual mouse observations from the MAGUIN-1 knock-out line phenotyping.

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude. PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio. Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4. LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Max fEPSP amplitude	µV	33 (11)	3050 (110)	40 (11)	3230 (110)	7.8e-05 ***	0.47
PPF at 50ms, ampl ratio	%	31 (10)	178.1 (3.3)	40 (11)	168.1 (1.8)	0.46	0.011 *
Burst 1, PPF at 10ms, ampl ratio	%	33 (11)	192.9 (4.8)	40 (11)	154.7 (3.1)	0.28	4e-06 ***
Burst 1, EPSP3 depr, ampl ratio	%	33 (11)	65.1 (1.9)	40 (11)	69.8 (1.7)	0.33	0.095
Burst 1, ave amplitude	µV	33 (11)	1278 (32)	40 (11)	1372 (46)	1e-06 ***	0.32
Burst 2, ave amplitude	µV	33 (11)	2000 (65)	40 (11)	2349 (83)	6.6e-08 ***	0.063
Burst 3, ave amplitude	µV	33 (11)	2283 (79)	40 (11)	2507 (88)	3.4e-07 ***	0.26
Burst 4, ave amplitude	µV	33 (11)	2370 (79)	40 (11)	2572 (86)	3.2e-07 ***	0.3
Burst 5, ave amplitude	µV	33 (11)	2345 (75)	40 (11)	2539 (83)	4.1e-07 ***	0.3
Burst 6, ave amplitude	µV	33 (11)	2284 (72)	40 (11)	2486 (81)	3.3e-07 ***	0.26
Burst 7, ave amplitude	µV	33 (11)	2205 (68)	40 (11)	2400 (80)	2.3e-07 ***	0.27
Burst 8, ave amplitude	µV	33 (11)	2131 (68)	40 (11)	2327 (78)	1.6e-07 ***	0.26
Burst 9, ave amplitude	µV	33 (11)	2071 (67)	40 (11)	2262 (78)	2.7e-07 ***	0.27
Burst 10, ave amplitude	µV	33 (11)	2016 (65)	40 (11)	2199 (75)	3e-07 ***	0.27
Burst 2-4 ave amplitude vs Burst 1	%	33 (11)	173.6 (2.8)	40 (11)	181.6 (2.5)	0.26	0.064
Burst 8-10 ave amplitude vs Burst 2-4	%	33 (11)	94 (0.9)	40 (11)	91.4 (0.6)	0.027 *	0.058
LTP vs PTP, amplitude ratio	%	33 (11)	78.4 (0.8)	40 (11)	80.1 (0.8)	0.67	0.11
LTP based on amplitude	%	33 (11)	172.8 (4.2)	40 (11)	156.8 (2.8)	0.11	0.011 *

Basal Synaptic Transmission

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Max fEPSP amplitude	µV	33 (11)	3050 (110)	40 (11)	3230 (110)	7.8e-05 ***	0.47

Paired Pulse Facilitation

 

Variables shown are: PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
PPF at 50ms, ampl ratio	%	31 (10)	178.1 (3.3)	40 (11)	168.1 (1.8)	0.46	0.011 *

Theta Burst Stimulation

 

Variables shown are: Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Burst 1, PPF at 10ms, ampl ratio	%	33 (11)	192.9 (4.8)	40 (11)	154.7 (3.1)	0.28	4e-06 ***
Burst 1, EPSP3 depr, ampl ratio	%	33 (11)	65.1 (1.9)	40 (11)	69.8 (1.7)	0.33	0.095
Burst 1, ave amplitude	µV	33 (11)	1278 (32)	40 (11)	1372 (46)	1e-06 ***	0.32
Burst 2, ave amplitude	µV	33 (11)	2000 (65)	40 (11)	2349 (83)	6.6e-08 ***	0.063
Burst 3, ave amplitude	µV	33 (11)	2283 (79)	40 (11)	2507 (88)	3.4e-07 ***	0.26
Burst 4, ave amplitude	µV	33 (11)	2370 (79)	40 (11)	2572 (86)	3.2e-07 ***	0.3
Burst 5, ave amplitude	µV	33 (11)	2345 (75)	40 (11)	2539 (83)	4.1e-07 ***	0.3
Burst 6, ave amplitude	µV	33 (11)	2284 (72)	40 (11)	2486 (81)	3.3e-07 ***	0.26
Burst 7, ave amplitude	µV	33 (11)	2205 (68)	40 (11)	2400 (80)	2.3e-07 ***	0.27
Burst 8, ave amplitude	µV	33 (11)	2131 (68)	40 (11)	2327 (78)	1.6e-07 ***	0.26
Burst 9, ave amplitude	µV	33 (11)	2071 (67)	40 (11)	2262 (78)	2.7e-07 ***	0.27
Burst 10, ave amplitude	µV	33 (11)	2016 (65)	40 (11)	2199 (75)	3e-07 ***	0.27
Burst 2-4 ave amplitude vs Burst 1	%	33 (11)	173.6 (2.8)	40 (11)	181.6 (2.5)	0.26	0.064
Burst 8-10 ave amplitude vs Burst 2-4	%	33 (11)	94 (0.9)	40 (11)	91.4 (0.6)	0.027 *	0.058

Long Term Potentiation

 

Variables shown are: LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
LTP vs PTP, amplitude ratio	%	33 (11)	78.4 (0.8)	40 (11)	80.1 (0.8)	0.67	0.11
LTP based on amplitude	%	33 (11)	172.8 (4.2)	40 (11)	156.8 (2.8)	0.11	0.011 *