G2C::Genetics

S-SCAM knock-out mouse

S.G.N. Grant and the G2C Consortium

Corresponding email: Seth.Grant@ed.ac.uk  

 

G2CMine Data Warehouse

Magi2 @ G2CMine

Genetic and Genomic Information

Gene symbol Magi2
MGI ID MGI:1354953
G2Cdb mouse G00003296
Ensembl mouse unknown
G2Cdb human G00006286
Ensembl human unknown

G2CMine Data Warehouse

G2CMine integrates the scientific findings of the Genes to Cognition Programme that utilised neuroproteomics, psychiatric genetics, high-throughput mouse gene targeting combined with behavioural and electrophysiological phenotyping and informatics in order to develop a general strategy for understanding cognition at the molecular, cellular and systems neuroscience levels.

G2CMine provides comprehensive Gene Ontology, Mammalian Phenotype Ontology, Human Phenotype Ontology, UniProt, genetic and protein interactions, and regional mouse brain expression results, together with the phenotyping results of the G2C Programme.

Mutation

Enlarge this image (847 x 716)

E14TG2a mouse embryonic stem (ES) cells were targeted with a vector containing 5.9kb and 2.9kb of flanking genomic DNA. This replaced 2.3 kb of Magi2 genomic DNA (X19,721,359 to X19723711; Ensemble Build 50) with IRES-lacZ-neo cassette. Correctly targeted ES cells were identified by long range PCR using Expand Long Template PCR system (Roche Cat 11681842001). The PCR contained primer X (5’-GAGCTATTCCAGAAGTAGTGAG-3’) and primer Y (5’- CAAGATCAGTTGTCATCGGAG -3’) that correspond to sequence in the IRES-lacZ-neo cassette and sequence outside the 2.9kb flanking region respectively.

The correctly targeted ES cells were injected into C57BL/6 blastocysts to create chimeric mice, which were bred with 129S5 mice to generate heterozygous (+/–) Magi2 mutant mice. Those F1 heterozygous mice had been backcrossed with 129S5 mice for 1-2 times before being used for intercrossing.

Location of Magi2 gene trap. Magi2, a 23 exon gene, encodes the protein S-SCAM which contains GK, WW and multiple PDZ domains (top). We replaced most of Magi2 exon 5 with a selection cassette in targeted mice and created a frameshift between exons 5 and 6. Primers used for targeted clone identification (X&Y) are shown.

Genotyping

Enlarge this image (1268 x 342)

Genomic DNA was isolated from ES cells by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 490bp product amplified from the wild-type (wt) allele using a forward primer A (GTCTGACTTTGTGCTTATCAG) in the wt sequence deleted by targeted mutation and a reverse primer B (CTCAGCTAGTACTCTAGAAG) downstream of the cassette. A 600bp product was amplified from the targeted allele using primer B with forward primer X, within the selection cassette. After enzymatic amplification for 35 cycles (45 seconds at 94 °C, 45 seconds at 55 °C, and 1 minute at 72 °C), the PCR products were size-fractionated on a 2% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (A,B & X). PCR genotyping of targeted S-SCAM mice using a common reverse primer, B, and forward primers A and X to amplify the wt and mutant alleles respectively.

Expression

Enlarge this image (581 x 186)

Hippocampal extracts from S-SCAM heterozygous mutant mice and wildtype mice were run on a 6% SDS-polyacrylamide gel and immunoblotted for S-SCAM (1:1000, polyclonal antiserum, a kind gift from Dr Yutaka Hata). There was significant reduction in S-SCAM protein levels in the heterozygous mutant mice compared with wildtype mice.

Breeding

Birth of S-SCAM-/- mice did not follow Mendelian ratios with 5% of offspring being homozygous knockouts; these progeny did not survive beyond birth but tissue was collected for post mortem genotyping. Genotypes from S-SCAM+/- intercrosses identified 49 wt, 89 S-SCAM+/- and 7 S-SCAM-/- progeny (Χ2 p= <0.001). Male and female S-SCAM+/- mice developed normally to adulthood, exhibited normal body size and no gross abnormalities. Backcrosses onto the 129S5/SvEvBrd background were used to maintain the S-SCAM colony and to generate heterozygous and wildtype mice to study.

Overview

Mutant mice showed little overall behavioural difference from wildtypes. With heterozygous genotype and no behavioural variables significantly affected in mutants, this mutation was deemed haplosufficient.

Enlarge this image (600 x 700)

The G2CMine data warehouse provides cohort summaries and individual mouse observations from the S-SCAM knock-out line phenotyping.

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM. OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field. RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1. Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable Units Wildtype M (n=10) Wildtype F (n=15) Mutant M (n=11) Mutant F (n=15) P(sex×mutation) P(mutation)
EPM total distance cm 844 (89) 671 (38) 851 (75) 651 (38) 0.82 0.88
EPM max speed cm/s 16.2 (1.4) 15 (0.9) 18.1 (1.2) 14.6 (0.9) 0.31 0.62
EPM % time in open % 40.9 (11.2) 30.4 (8) 32 (6.6) 43.7 (7.9) 0.2 0.62
EPM time in centre s 131.3 (14.7) 149.1 (14.5) 129 (15.8) 167.5 (9.3) 0.45 0.47
EPM max speed, open vs closed cm/s -3 (1.5) -3 (1.4) -4.3 (1.2) -3 (1.1) 0.63 0.7
OF, NOE total distance log10 cm 3.1 (0.1) 3.24 (0.07) 3.08 (0.08) 3.03 (0.06) 0.22 0.095
NOE vs OF distance travelled cm -380 (130) 60 (150) -270 (150) -190 (120) 0.21 0.45
RR naive fall time log10 s 1.19 (0.13) 1.17 (0.1) 1.21 (0.11) 1.18 (0.08) 0.94 0.87
RR learning s/trial 5.2 (2.2) 3 (1.1) 0.9 (0.9) 2.4 (0.7) 0.14 0.089
RR memory s 1.9 (5.5) 7.2 (2.9) 17 (7.2) 7.8 (3.7) 0.13 0.17
Fear learning, trial effect % freezing 49.7 (9.5) 63 (6.9) 34.6 (6.9) 48.9 (6.2) 0.94 0.051
Fear learning, tone effect % freezing 1.5 (9.4) 1.1 (4.2) 10.7 (7.5) 6.9 (4) 0.78 0.23
Contextual memory, mean % freezing 39.5 (7.5) 53.6 (4.6) 37.3 (4.3) 49.1 (4.6) 0.82 0.5
Contextual memory, change % freezing 29.8 (8.3) 34.9 (5.7) 54 (4.3) 36.7 (6.6) 0.092 0.09
Cued memory, mean % freezing -5.8 (6.8) -6.7 (6.2) -6.3 (5.5) -0.1 (5.7) 0.57 0.55
Cued memory, change % freezing 5.3 (8.5) 5.6 (4.2) -0.2 (7.6) 6.3 (4) 0.61 0.75
TXTCSVXLS

Elevated Plus Maze

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM.

 

Variable Units Wildtype M (n=10) Wildtype F (n=15) Mutant M (n=11) Mutant F (n=15) P(sex×mutation) P(mutation)
EPM total distance cm 844 (89) 671 (38) 851 (75) 651 (38) 0.82 0.88
EPM max speed cm/s 16.2 (1.4) 15 (0.9) 18.1 (1.2) 14.6 (0.9) 0.31 0.62
EPM % time in open % 40.9 (11.2) 30.4 (8) 32 (6.6) 43.7 (7.9) 0.2 0.62
EPM time in centre s 131.3 (14.7) 149.1 (14.5) 129 (15.8) 167.5 (9.3) 0.45 0.47
EPM max speed, open vs closed cm/s -3 (1.5) -3 (1.4) -4.3 (1.2) -3 (1.1) 0.63 0.7
TXTCSVXLS

Open Field/Novel Object

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field.

 

Variable Units Wildtype M (n=10) Wildtype F (n=15) Mutant M (n=11) Mutant F (n=15) P(sex×mutation) P(mutation)
OF, NOE total distance log10 cm 3.1 (0.1) 3.24 (0.07) 3.08 (0.08) 3.03 (0.06) 0.22 0.095
NOE vs OF distance travelled cm -380 (130) 60 (150) -270 (150) -190 (120) 0.21 0.45
TXTCSVXLS

Rotarod

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1.

 

Variable Units Wildtype M (n=10) Wildtype F (n=15) Mutant M (n=11) Mutant F (n=15) P(sex×mutation) P(mutation)
RR naive fall time log10 s 1.19 (0.13) 1.17 (0.1) 1.21 (0.11) 1.18 (0.08) 0.94 0.87
RR learning s/trial 5.2 (2.2) 3 (1.1) 0.9 (0.9) 2.4 (0.7) 0.14 0.089
RR memory s 1.9 (5.5) 7.2 (2.9) 17 (7.2) 7.8 (3.7) 0.13 0.17
TXTCSVXLS

Fear Conditioning

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable Units Wildtype M (n=10) Wildtype F (n=15) Mutant M (n=11) Mutant F (n=15) P(sex×mutation) P(mutation)
Fear learning, trial effect % freezing 49.7 (9.5) 63 (6.9) 34.6 (6.9) 48.9 (6.2) 0.94 0.051
Fear learning, tone effect % freezing 1.5 (9.4) 1.1 (4.2) 10.7 (7.5) 6.9 (4) 0.78 0.23
Contextual memory, mean % freezing 39.5 (7.5) 53.6 (4.6) 37.3 (4.3) 49.1 (4.6) 0.82 0.5
Contextual memory, change % freezing 29.8 (8.3) 34.9 (5.7) 54 (4.3) 36.7 (6.6) 0.092 0.09
Cued memory, mean % freezing -5.8 (6.8) -6.7 (6.2) -6.3 (5.5) -0.1 (5.7) 0.57 0.55
Cued memory, change % freezing 5.3 (8.5) 5.6 (4.2) -0.2 (7.6) 6.3 (4) 0.61 0.75
TXTCSVXLS

Overview

Mutant slices showed medium overall electrophysiological difference from wildtype slices. With heterozygous genotype and no electrophysiological variables significantly affected in mutant slices, this mutation was deemed haplosufficient. Note that in the theta burst analysis, the tenth burst is analysed as representative of individual burst amplitude.

Enlarge this image (600 x 700)

The G2CMine data warehouse provides slice group summaries and individual mouse observations from the S-SCAM knock-out line phenotyping.

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude. PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio. Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4. LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable Units Wildtype slices (animals) Wildtype mean (SEM) Mutant slices (animals) Mutant mean (SEM) P(animals) P(mutation)
Max fEPSP amplitude µV 15 (5) 2890 (170) 15 (5) 2610 (120) 0.3 0.29
PPF at 50ms, ampl ratio % 15 (5) 173.4 (5.4) 15 (5) 165.3 (5.1) 0.33 0.36
Burst 1, PPF at 10ms, ampl ratio % 15 (5) 194 (8.8) 15 (5) 203.5 (8.7) 0.48 0.47
Burst 1, EPSP3 depr, ampl ratio % 15 (5) 66.2 (3.6) 15 (5) 62.6 (3.8) 0.17 0.59
Burst 1, ave amplitude µV 15 (5) 1192 (53) 15 (5) 1062 (37) 0.57 0.079
Burst 2, ave amplitude µV 15 (5) 1800 (130) 15 (5) 1470 (130) 0.46 0.14
Burst 3, ave amplitude µV 15 (5) 2070 (160) 15 (5) 1660 (160) 0.29 0.15
Burst 4, ave amplitude µV 15 (5) 2190 (150) 15 (5) 1760 (150) 0.33 0.12
Burst 5, ave amplitude µV 15 (5) 2220 (140) 15 (5) 1770 (140) 0.32 0.091
Burst 6, ave amplitude µV 15 (5) 2170 (140) 15 (5) 1720 (140) 0.33 0.079
Burst 7, ave amplitude µV 15 (5) 2130 (140) 15 (5) 1660 (140) 0.34 0.065
Burst 8, ave amplitude µV 15 (5) 2080 (140) 15 (5) 1600 (140) 0.36 0.065
Burst 9, ave amplitude µV 15 (5) 2040 (150) 15 (5) 1540 (140) 0.36 0.06
Burst 10, ave amplitude µV 15 (5) 2000 (150) 15 (5) 1500 (140) 0.34 0.066
Burst 2-4 ave amplitude vs Burst 1 % 15 (5) 172.7 (7.4) 15 (5) 161.2 (9.5) 0.26 0.44
Burst 8-10 ave amplitude vs Burst 2-4 % 15 (5) 98.5 (2) 15 (5) 93 (2) 0.49 0.097
LTP vs PTP, amplitude ratio % 15 (5) 76.1 (2.2) 15 (5) 74.6 (1.4) 0.86 0.44
LTP based on amplitude % 15 (5) 174.2 (6) 15 (5) 168.1 (7.6) 0.83 0.44
TXTCSVXLS

Basal Synaptic Transmission

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude.

 

Variable Units Wildtype slices (animals) Wildtype mean (SEM) Mutant slices (animals) Mutant mean (SEM) P(animals) P(mutation)
Max fEPSP amplitude µV 15 (5) 2890 (170) 15 (5) 2610 (120) 0.3 0.29
TXTCSVXLS

Paired Pulse Facilitation

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

 

Variables shown are: PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio.

 

Variable Units Wildtype slices (animals) Wildtype mean (SEM) Mutant slices (animals) Mutant mean (SEM) P(animals) P(mutation)
PPF at 50ms, ampl ratio % 15 (5) 173.4 (5.4) 15 (5) 165.3 (5.1) 0.33 0.36
TXTCSVXLS

Theta Burst Stimulation

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4.

 

Variable Units Wildtype slices (animals) Wildtype mean (SEM) Mutant slices (animals) Mutant mean (SEM) P(animals) P(mutation)
Burst 1, PPF at 10ms, ampl ratio % 15 (5) 194 (8.8) 15 (5) 203.5 (8.7) 0.48 0.47
Burst 1, EPSP3 depr, ampl ratio % 15 (5) 66.2 (3.6) 15 (5) 62.6 (3.8) 0.17 0.59
Burst 1, ave amplitude µV 15 (5) 1192 (53) 15 (5) 1062 (37) 0.57 0.079
Burst 2, ave amplitude µV 15 (5) 1800 (130) 15 (5) 1470 (130) 0.46 0.14
Burst 3, ave amplitude µV 15 (5) 2070 (160) 15 (5) 1660 (160) 0.29 0.15
Burst 4, ave amplitude µV 15 (5) 2190 (150) 15 (5) 1760 (150) 0.33 0.12
Burst 5, ave amplitude µV 15 (5) 2220 (140) 15 (5) 1770 (140) 0.32 0.091
Burst 6, ave amplitude µV 15 (5) 2170 (140) 15 (5) 1720 (140) 0.33 0.079
Burst 7, ave amplitude µV 15 (5) 2130 (140) 15 (5) 1660 (140) 0.34 0.065
Burst 8, ave amplitude µV 15 (5) 2080 (140) 15 (5) 1600 (140) 0.36 0.065
Burst 9, ave amplitude µV 15 (5) 2040 (150) 15 (5) 1540 (140) 0.36 0.06
Burst 10, ave amplitude µV 15 (5) 2000 (150) 15 (5) 1500 (140) 0.34 0.066
Burst 2-4 ave amplitude vs Burst 1 % 15 (5) 172.7 (7.4) 15 (5) 161.2 (9.5) 0.26 0.44
Burst 8-10 ave amplitude vs Burst 2-4 % 15 (5) 98.5 (2) 15 (5) 93 (2) 0.49 0.097
TXTCSVXLS

Long Term Potentiation

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable Units Wildtype slices (animals) Wildtype mean (SEM) Mutant slices (animals) Mutant mean (SEM) P(animals) P(mutation)
LTP vs PTP, amplitude ratio % 15 (5) 76.1 (2.2) 15 (5) 74.6 (1.4) 0.86 0.44
LTP based on amplitude % 15 (5) 174.2 (6) 15 (5) 168.1 (7.6) 0.83 0.44
TXTCSVXLS
© G2C 2014. The Genes to Cognition Programme received funding from The Wellcome Trust and the EU FP7 Framework Programmes:
EUROSPIN (FP7-HEALTH-241498), SynSys (FP7-HEALTH-242167) and GENCODYS (FP7-HEALTH-241995).

Cookies Policy | Terms and Conditions. This site is hosted by Edinburgh University and the Genes to Cognition Programme.