G2C::Genetics

Mutation

A mouse embryonic stem (ES) cell line (XP0050, strain 129/Ola) with an insertional mutation in Akap9 was obtained from Sanger Institute Gene Trap Resource (SIGTR - sanger.ac.uk/PostGenomics/genetrap/). The insertional mutation in XP0050 by the gene-trapping vector, pGT0lxr, that was designed to create an in-frame fusion between the 5' exons of the trapped gene and a reporter, β-geo (a fusion of β-galactosidase and neomycin phosphotransferase II) occurred in intron 14-15. Thus, the gene-trapped locus is predicted to yield a fusion transcript containing exons 1-14 of Akap9 and β-geo.

The ES cells were injected into C57BL/6 blastocysts to create chimeric mice, which were bred with 129S5 mice to generate heterozygous (+/–) Akap9 mutant mice. Those F1 heterozygous mice had been backcrossed with 129S5 mice for 1-2 times before being used for intercrossing to produce homozygous mutants.

Location of Akap9 gene trap. Akap9 is a 48 exon gene encoding a protein which contains Tropomysin, Prefoldin and Glyco-hydro-cat domains (top). The Akap9 gene trap is located in intron 14-15.

Genotyping

Genomic DNA was isolated from ES cells or mouse tissues by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 1.3kb product amplified from the wild-type (wt) allele using a forward primer A (5'- CTTAGCCTGAGATGACTCAG -3') upstream of the cassette with reverse primer Y. A 1.6kb product was amplified from the targeted allele using primer A with reverse primer B (5’- GGTTACGTTGGTGTAGATGG -3’), within the β-geo cassette. After enzymatic amplification for 35 cycles (30 seconds at 94 °C, 1 minute at 55 °C, and 3 minutes at 72 °C), the PCR products were size-fractionated on a 1% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (a,b & y). PCR genotyping of gene trap Akap9 mice using a common forward primer, a, and reverse primers y and b to amplify the wt and mutant alleles respectively.

Expression

Total RNA was extracted from whole mouse brain using RNeasy Midi kit (Qiagen, Cat 75144). cDNA was generated and RT-PCR performed using primers X & Y. A product of 116bp was generated as before from WT cDNA and a 321bp product from homozygote cDNA. Sequence data showed that this homozygote product had 205bp of sequence from the gene trap insert. This change in sequence results in a frameshift and stop codon after 8 amino acids.

Primers used for RT-PCR (x,y & z): B. RT-PCR - forward primer X (within exon 14) and reverse primer Z (within the gene trap) are used to confirm the location of the trap. C. RT-PCR to detect loss of RNA - forward primer, X (as above) and reverse primer Y (within exon 15). A larger fusion protein is amplified in homozygous mice where a fusion of exons 1-14 and β-geo has occurred.

Breeding

Birth of Akap9^-/- mice followed Mendelian ratios with 25% of offspring being homozygous knockouts. Genotypes of 3-week-old pups from Akap9^+/- intercrosses identified 67 wt, 120 Akap9^+/- and 56 Akap9^-/- progeny (Χ² p= 0.597). Male and female Akap9^-/- mice developed normally to adulthood, exhibited normal body size and no gross abnormalities Akap9 mice were maintained by backcrossing onto the 129S5/SvEvBrd background; heterozygous males and females were fertile and used to set up intercrosses to generate homozygous and wildtype mice to study.

Overview

Mutant mice showed no discernible overall behavioural difference from wildtypes, with two of 16 behaviour variables significantly impacted by this mutation. In the fear learning task, one behavioural variable, fear learning tone effect, was significantly decreased in mutants. In the contextual memory task, one behavioural variable, contextual memory change, was significantly decreased in mutants. Elevated plus maze, open field/novel object exploration, rotarod and cued memory tasks were unaffected. Definitions of variables may be found below.

The G2CMine data warehouse provides cohort summaries and individual mouse observations from the Akap9 knock-out line phenotyping.

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM. OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field. RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1. Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable	Units	Wildtype M (n=14)	Wildtype F (n=14)	Mutant M (n=12)	Mutant F (n=17)	P(sex×mutation)	P(mutation)
EPM total distance	cm	559 (47)	839 (68)	879 (44)	643 (46)	0.0000095 ***	0.46
EPM max speed	cm/s	12.7 (0.8)	16.1 (0.9)	17.2 (0.9)	14.9 (0.9)	0.0018 **	0.12
EPM % time in open	%	32.6 (9.3)	27.5 (6.7)	27.9 (10.3)	31.8 (6.5)	0.59	0.98
EPM time in centre	s	135 (15)	129 (12)	119 (12)	149 (16)	0.22	0.81
EPM max speed, open vs closed	cm/s	-4.4 (1.3)	-4.1 (1.3)	-4.3 (2.6)	-4.2 (1.1)	0.93	0.99
OF, NOE total distance	log10 cm	3.03 (0.09)	3.08 (0.08)	3.12 (0.07)	3.19 (0.07)	0.92	0.19
NOE vs OF distance travelled	cm	-300 (103)	-195 (78)	-379 (92)	-197 (127)	0.72	0.73
RR naive fall time	log10 s	0.85 (0.07)	0.97 (0.06)	0.76 (0.05)	0.94 (0.07)	0.68	0.4
RR learning	s/trial	2.6 (0.8)	2 (0.9)	0.9 (0.4)	1 (0.5)	0.6	0.05
RR memory	s	9.8 (3.9)	2.3 (2.8)	5.2 (2.8)	10.4 (3.2)	0.059	0.49
Fear learning, trial effect	% freezing	45.7 (7.1)	49.2 (7.6)	48.7 (7)	46 (5.6)	0.65	0.96
Fear learning, tone effect	% freezing	-8.8 (6.2)	14.5 (5)	-14.3 (4.2)	-4.6 (4.7)	0.19	0.015 *
Contextual memory, mean	% freezing	42.7 (5.8)	41.4 (6.3)	41.9 (6.9)	45.6 (5.2)	0.68	0.75
Contextual memory, change	% freezing	31.5 (4.6)	30.2 (4.7)	19.1 (5.9)	13.2 (8.1)	0.72	0.023 *
Cued memory, mean	% freezing	-5.2 (6.7)	11.1 (7.6)	0.7 (3.6)	0.9 (3.9)	0.16	0.62
Cued memory, change	% freezing	6.3 (5.2)	8.5 (8.5)	8.3 (8.2)	5.3 (4.1)	0.69	0.9

Elevated Plus Maze

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM.

 

Variable	Units	Wildtype M (n=14)	Wildtype F (n=14)	Mutant M (n=12)	Mutant F (n=17)	P(sex×mutation)	P(mutation)
EPM total distance	cm	559 (47)	839 (68)	879 (44)	643 (46)	0.0000095 ***	0.46
EPM max speed	cm/s	12.7 (0.8)	16.1 (0.9)	17.2 (0.9)	14.9 (0.9)	0.0018 **	0.12
EPM % time in open	%	32.6 (9.3)	27.5 (6.7)	27.9 (10.3)	31.8 (6.5)	0.59	0.98
EPM time in centre	s	135 (15)	129 (12)	119 (12)	149 (16)	0.22	0.81
EPM max speed, open vs closed	cm/s	-4.4 (1.3)	-4.1 (1.3)	-4.3 (2.6)	-4.2 (1.1)	0.93	0.99

Open Field/Novel Object

 

Variables shown are: OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field.

 

Variable	Units	Wildtype M (n=14)	Wildtype F (n=14)	Mutant M (n=12)	Mutant F (n=17)	P(sex×mutation)	P(mutation)
OF, NOE total distance	log10 cm	3.03 (0.09)	3.08 (0.08)	3.12 (0.07)	3.19 (0.07)	0.92	0.19
NOE vs OF distance travelled	cm	-300 (103)	-195 (78)	-379 (92)	-197 (127)	0.72	0.73

Rotarod

 

Variables shown are: RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1.

 

Variable	Units	Wildtype M (n=14)	Wildtype F (n=14)	Mutant M (n=12)	Mutant F (n=17)	P(sex×mutation)	P(mutation)
RR naive fall time	log10 s	0.85 (0.07)	0.97 (0.06)	0.76 (0.05)	0.94 (0.07)	0.68	0.4
RR learning	s/trial	2.6 (0.8)	2 (0.9)	0.9 (0.4)	1 (0.5)	0.6	0.05
RR memory	s	9.8 (3.9)	2.3 (2.8)	5.2 (2.8)	10.4 (3.2)	0.059	0.49

Fear Conditioning

 

Variables shown are: Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable	Units	Wildtype M (n=14)	Wildtype F (n=14)	Mutant M (n=12)	Mutant F (n=17)	P(sex×mutation)	P(mutation)
Fear learning, trial effect	% freezing	45.7 (7.1)	49.2 (7.6)	48.7 (7)	46 (5.6)	0.65	0.96
Fear learning, tone effect	% freezing	-8.8 (6.2)	14.5 (5)	-14.3 (4.2)	-4.6 (4.7)	0.19	0.015 *
Contextual memory, mean	% freezing	42.7 (5.8)	41.4 (6.3)	41.9 (6.9)	45.6 (5.2)	0.68	0.75
Contextual memory, change	% freezing	31.5 (4.6)	30.2 (4.7)	19.1 (5.9)	13.2 (8.1)	0.72	0.023 *
Cued memory, mean	% freezing	-5.2 (6.7)	11.1 (7.6)	0.7 (3.6)	0.9 (3.9)	0.16	0.62
Cued memory, change	% freezing	6.3 (5.2)	8.5 (8.5)	8.3 (8.2)	5.3 (4.1)	0.69	0.9

Overview

Mutant slices showed medium overall electrophysiological difference from wildtype slices, with three of nine variables significantly impacted in these mutants. In the paired pulse facilitation experiment, PPF at 50ms ampl ratio was significantly decreased in mutants. In the theta burst stimulation experiment, one electrophysiological variable, burst 1 PPF at 10ms ampl ratio, was significantly decreased in mutants. In the long term potentiation experiment, one electrophysiological variable, LTP based on amplitude, was significantly decreased in mutants. Only the basal synaptic transmission experiment was unaffected. Note that in the theta burst analysis, the tenth burst is analysed as representative of individual burst amplitude. Definitions of variables may be found below.

The G2CMine data warehouse provides slice group summaries and individual mouse observations from the Akap9 knock-out line phenotyping.

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude. PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio. Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4. LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Max fEPSP amplitude	µV	17 (6)	3050 (120)	26 (9)	3050 (160)	0.012 *	1
PPF at 50ms, ampl ratio	%	17 (6)	178.9 (2.5)	26 (9)	171.6 (2.5)	0.71	0.048 *
Burst 1, PPF at 10ms, ampl ratio	%	17 (6)	211.6 (6.3)	26 (9)	180.3 (3.6)	0.88	0.00017 ***
Burst 1, EPSP3 depr, ampl ratio	%	17 (6)	66.6 (3)	26 (9)	67.1 (2.2)	0.19	0.9
Burst 1, ave amplitude	µV	17 (6)	1253 (38)	26 (9)	1335 (62)	0.0087 **	0.49
Burst 2, ave amplitude	µV	17 (6)	1932 (66)	26 (9)	2011 (95)	0.0013 **	0.69
Burst 3, ave amplitude	µV	17 (6)	2223 (81)	26 (9)	2271 (106)	0.0014 **	0.83
Burst 4, ave amplitude	µV	17 (6)	2322 (86)	26 (9)	2367 (101)	0.002 **	0.83
Burst 5, ave amplitude	µV	17 (6)	2309 (80)	26 (9)	2350 (96)	0.0025 **	0.84
Burst 6, ave amplitude	µV	17 (6)	2254 (76)	26 (9)	2286 (90)	0.0025 **	0.87
Burst 7, ave amplitude	µV	17 (6)	2185 (73)	26 (9)	2222 (86)	0.0053 **	0.84
Burst 8, ave amplitude	µV	17 (6)	2110 (72)	26 (9)	2153 (86)	0.0039 **	0.81
Burst 9, ave amplitude	µV	17 (6)	2051 (76)	26 (9)	2097 (83)	0.0034 **	0.79
Burst 10, ave amplitude	µV	17 (6)	1995 (74)	26 (9)	2036 (81)	0.0056 **	0.81
Burst 2-4 ave amplitude vs Burst 1	%	17 (6)	173.5 (3.1)	26 (9)	167.6 (3.4)	0.098	0.35
Burst 8-10 ave amplitude vs Burst 2-4	%	17 (6)	95.4 (1.6)	26 (9)	95.5 (1.4)	0.8	0.96
LTP vs PTP, amplitude ratio	%	17 (6)	80.7 (1.2)	26 (9)	77.5 (1.4)	0.14	0.18
LTP based on amplitude	%	17 (6)	185.7 (5.3)	26 (9)	167.4 (3.2)	0.35	0.013 *

Basal Synaptic Transmission

 

Variables shown are: Max fEPSP amplitude, Maximum field excitatory postsynaptic potential (fEPSP) amplitude.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Max fEPSP amplitude	µV	17 (6)	3050 (120)	26 (9)	3050 (160)	0.012 *	1

Paired Pulse Facilitation

 

Variables shown are: PPF at 50ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 50ms, amplitude ratio.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
PPF at 50ms, ampl ratio	%	17 (6)	178.9 (2.5)	26 (9)	171.6 (2.5)	0.71	0.048 *

Theta Burst Stimulation

 

Variables shown are: Burst 1, PPF at 10ms, ampl ratio, Paired pulse facilitation (PPF), pulses separated by 10ms, amplitude ratio, observed during first two pulses of the first 100Hz burst during theta-burst stimulation. Burst 1, EPSP3 depr, ampl ratio, Depression observed in third fEPSP relative to the second fEPSP of the first 100Hz burst, amplitude ratio. Burst 1, ave amplitude, Average amplitude of four fEPSPs in first burst. Burst 2, ave amplitude, Average amplitude of four fEPSPs in second burst. Burst 3, ave amplitude, Average amplitude of four fEPSPs in third burst. Burst 4, ave amplitude, Average amplitude of four fEPSPs in fourth burst. Burst 5, ave amplitude, Average amplitude of four fEPSPs in fifth burst. Burst 6, ave amplitude, Average amplitude of four fEPSPs in sixth burst. Burst 7, ave amplitude, Average amplitude of four fEPSPs in seventh burst. Burst 8, ave amplitude, Average amplitude of four fEPSPs in eighth burst. Burst 9, ave amplitude, Average amplitude of four fEPSPs in ninth burst. Burst 10, ave amplitude, Average amplitude of four fEPSPs in tenth burst. Burst 2-4 ave amplitude vs Burst 1, Facilitation observed in average amplitude of bursts 2-4, relative to average amplitude of burst 1. Burst 8-10 ave amplitude vs Burst 2-4, Depression observed in average amplitude of bursts 8-10, relative to average amplitude of bursts 2-4.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
Burst 1, PPF at 10ms, ampl ratio	%	17 (6)	211.6 (6.3)	26 (9)	180.3 (3.6)	0.88	0.00017 ***
Burst 1, EPSP3 depr, ampl ratio	%	17 (6)	66.6 (3)	26 (9)	67.1 (2.2)	0.19	0.9
Burst 1, ave amplitude	µV	17 (6)	1253 (38)	26 (9)	1335 (62)	0.0087 **	0.49
Burst 2, ave amplitude	µV	17 (6)	1932 (66)	26 (9)	2011 (95)	0.0013 **	0.69
Burst 3, ave amplitude	µV	17 (6)	2223 (81)	26 (9)	2271 (106)	0.0014 **	0.83
Burst 4, ave amplitude	µV	17 (6)	2322 (86)	26 (9)	2367 (101)	0.002 **	0.83
Burst 5, ave amplitude	µV	17 (6)	2309 (80)	26 (9)	2350 (96)	0.0025 **	0.84
Burst 6, ave amplitude	µV	17 (6)	2254 (76)	26 (9)	2286 (90)	0.0025 **	0.87
Burst 7, ave amplitude	µV	17 (6)	2185 (73)	26 (9)	2222 (86)	0.0053 **	0.84
Burst 8, ave amplitude	µV	17 (6)	2110 (72)	26 (9)	2153 (86)	0.0039 **	0.81
Burst 9, ave amplitude	µV	17 (6)	2051 (76)	26 (9)	2097 (83)	0.0034 **	0.79
Burst 10, ave amplitude	µV	17 (6)	1995 (74)	26 (9)	2036 (81)	0.0056 **	0.81
Burst 2-4 ave amplitude vs Burst 1	%	17 (6)	173.5 (3.1)	26 (9)	167.6 (3.4)	0.098	0.35
Burst 8-10 ave amplitude vs Burst 2-4	%	17 (6)	95.4 (1.6)	26 (9)	95.5 (1.4)	0.8	0.96

Long Term Potentiation

 

Variables shown are: LTP vs PTP, amplitude ratio, Reduction in potentiation from immediately after theta-burst stimulation to one hour later, fEPSP amplitude ratio. LTP based on amplitude, Long term potentiation, ratio of amplitudes of fEPSPs in test pathway and control pathway.

 

Variable	Units	Wildtype slices (animals)	Wildtype mean (SEM)	Mutant slices (animals)	Mutant mean (SEM)	P(animals)	P(mutation)
LTP vs PTP, amplitude ratio	%	17 (6)	80.7 (1.2)	26 (9)	77.5 (1.4)	0.14	0.18
LTP based on amplitude	%	17 (6)	185.7 (5.3)	26 (9)	167.4 (3.2)	0.35	0.013 *