G2C::Genetics

Genotyping

Genomic DNA was isolated from ES cells by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 187bp product amplified from the wild-type (wt) allele using a forward primer B (CTATCATGAGTGTGTCAGGTC) and reverse primer C (CAGAGCCCAAGACTAATACAC). A 224bp product was amplified from the targeted allele using forward primer A (CTTGTCCACGGTTGTCCTTC) with reverse primer C. After enzymatic amplification for 35 cycles (45 seconds at 94 °C, 45 seconds at 55 °C, and 1 minute at 72 °C), the PCR products were size-fractionated on a 2% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (A,B & C). PCR genotyping of targeted Drebrin mice using a common reverse primer, C, and forward primers B and A to amplify the wt and mutant alleles respectively.

Expression

Total RNA was extracted from whole mouse brain using RNeasy Midi kit (Qiagen, Cat 75144). RT-PCR was performed by generating first strand cDNA and using forward primer, Y (GAGGTGATCCGGGAGGAGAG), which anneals to exon 1 and reverse primer, Z (CATCAGGCACATCCTCACCAAC), which anneals to exon 4. A product of 222bp was generated from WT cDNA and no product was detected from homozygous cDNA where the exons have been removed by Cre recombinase.

Primers used for RT-PCR (Y & Z) RT-PCR genotyping using forward primer Y, in exon 1, and reverse primer Z, in exon 4. A product of 222bp was generated from WT cDNA and no product was detected from homozygous cDNA where the exons have been removed by Cre recombinase.

Breeding

Birth of Drebrin^-/- mice followed Mendelian ratios with 21% of offspring being homozygous knockouts. Genotypes of 3-week-old pups from Drebrin^+/- intercrosses identified 60 wt, 95 Drebrin^+/- and 40 Drebrin^-/- progeny (Χ² p= 0.12). Male and female Drebrin^-/- mice developed normally to adulthood, exhibited normal body size and no gross abnormalities. Drebrin^+/- mice were maintained by backcrossing onto the C57BL/6J (Charles River) background; heterozygous males and females were fertile and used to set up intercrosses to generate homozygous and wildtype mice to study.