G2C::Genetics

Traf2 and NcK interacting Kinase (TNiK) contains serine-threonine kinase and scaffold domains and has been implicated in cell proliferation and glutamate receptor regulation in vitro. Here we report its role in vivo using mice carrying a knockout mutation.

TNiK binds protein complexes in the synapse linking it to the NMDA receptor (NMDAR) via AKAP9. NMDAR and metabotropic receptors bidirectionally regulate TNiK phosphorylation and TNiK was required for AMPA expression and synaptic function. TNiK also organises nuclear complexes and in the absence of TNiK, there was a marked elevation in GSK3Β and phosphorylation levels of its cognate phosphorylation sites on NeuroD1 with alterations in Wnt pathway signalling.

We observed impairments in dentate gyrus neurogenesis in TNiK knockout mice and cognitive testing using the touchscreen apparatus revealed impairments in pattern separation on a test of spatial discrimination. Object-location paired associates learning, which is dependent on glutamatergic signalling was also impaired. Additionally, TNiK knockout mice displayed hyperlocomotor behavior that could be rapidly reversed by GSK3Β inhibitors, indicating the potential for pharmacological rescue of a behavioral phenotype.

These data establish TNiK as a critical regulator of cognitive functions and suggest it may play a regulatory role in diseases impacting on its interacting proteins and complexes.

Supplementary Figure 1. Generation of AKAP9 mutant mice

A mouse embryonic stem (ES) cell line (XP0050, strain 129/Ola) with an insertional mutation in Akap9 was obtained from Sanger Institute Gene Trap Resource (SIGTR - sanger.ac.uk/PostGenomics/genetrap/). The insertional mutation in XP0050 by the gene-trapping vector, pGT0lxr, was designed to create an in-frame fusion between the 5' exons of the trapped gene and a reporter, Β-geo (a fusion of Β-galactosidase and neomycin phosphotransferase II) occurred in intron 14-15 (Transcript: Akap9-001 (ENSMUST00000044492) Ensembl release 56). Thus, the gene-trapped locus is predicted to yield a fusion transcript containing exons 1-14 of Akap9 and Β-geo. Integration of the gene-trapping vector was confirmed by RT-PCR. A 217bp product was amplified from the gene trap clone cDNA using primer x (GAAGCTGTCTAAGAGAGTGTG) that hybridises the sequence encoded by the part of exon 14 with reverse Primer z (GATCCTCTAGAGTCCAGATCTG) within the Β-geo cassette. This gene trap ES cell clone was injected into C57/BL6 blastocysts to create chimeric mice, which were bred with 129S5 mice to generate heterozygous (+/–) Akap9 mutant mice. Those F1 heterozygous mice had been backcrossed with 129S5 mice for 1-2 times before being used for intercrossing.

TNiK Supplementary Figure 1

A. Gene trap vector for the generation of AKAP9 knockout mice. Linear structure of AKAP9 protein domain (top diagram). AKAP9 is a 48 exon protein. The gene-trapping vector, pGT0lxr, is inserted between exon14 and 15. Primers used for genotyping (see supplementary methods) are shown (bottom diagram). SA, splice acceptor; pA, polyadenylation signal; Β-geo, fusion of Β-galactosidase and neomycin phosphotransferase II.

B. Electrophoresis gel image showing confirmation by RTPCR that trap is correctly inserted.

C. RT-PCR genotyping. Homozygote (-/-) product is 205bp larger than wt (+/+) product.

D. PCR genotyping of targeted AKAP9^-/- mice using a common forward primer, a, and reverse primers b and y to amplify the wt and mutant alleles respectively.

Supplementary Table 1. Hippocampal mRNA expression profile of TNiK^-/- mice

Shown are the 200 most significant genes from the mRNA expression profiling, the whole genome array results are downloadable.

Download whole genome microarray results

Supplementary Table 2. Antibodies used in WB, IP, IHC and IF assays

List of antibodies used in biochemical assays. Antibody: antibody target; Assay: assay in which the antibody was used; Dilution/concentration: Dilution and/or concentration used for each antibody; Company and Catalogue Number: company name and catalogue number for commercially available antibodies.